Official NEET 2023 Zoology Question 188 (Booklet G5)

Q.188 Zoology ⭐ 360° Option Elimination Active

Vault ↗

NEET 2023 Zoology Question 188 Solution

Topic: Molecular Basis of Inheritance · Official NTA Booklet Code G5

NEET 2023 Zoology Question 188: Transcription Unit: Coding Strand vs. Template Strand and mRNA Sequence

✓

Verified Against NTA Final Answer Key

Option (4) : 5’ ATCGATCGATCGATCGATCGATCGATCG 3’

📚 Molecular Basis of Inheritance Easy

📋 Given Parameters & Problem Setup

mRNA Sequence 5’ AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3’

Target Strand Corresponding coding strand of DNA

⚡

The 30-Second Exam Hall Shortcut: ⚡ Golden Rule: Coding Strand = mRNA (Just Replace U with T!)

⏱️ Save ~25 seconds

The sequence of the coding strand is 100% identical in sequence and polarity (5′ to 3′) to the mRNA formed, with the only single change being Thymine (T) in place of Uracil (U)! Match Option (4) directly!

1 By convention, the coding strand has the same sequence as the RNA transcript (except T for U).

2 Polarity of mRNA = 5′ to 3′; therefore polarity of coding strand = 5′ to 3′.

3 Take the mRNA: 5′ AUCGAUCG... 3′.

4 Substitute T for U: 5′ ATCGATCG... 3′.

5 Match Option (4) 5’ ATCGATCGATCGATCGATCGATCGATCG 3’.

🛡️

Why You Can 100% Trust This Shortcut: Canonical NCERT Molecular Genetics transcription unit strand polarity convention.

📐

Step-by-Step Rigorous Workflow & Mathematical Proof

Step 1

Transcription Conventions in Molecular Genetics

The DNA strand with $3' \to 5'$ polarity acts as the template for RNA polymerase. The other strand with $5' \to 3'$ polarity has the sequence identical to mRNA (except $T$ instead of $U$ ) and is termed the coding strand:

\begin{aligned} \text{Template Strand (} 3' \to 5' \text{):} & \quad 3'\text{ TAGCTAGCTAGCTAGCTAGCTAGCTAGC } 5' \\[4pt] \mathbf{\text{mRNA (}} 5' \to 3' \mathbf{\text{):}} & \quad 5'\text{ \textbf{AUCGAUCGAUCGAUCGAUCGAUCGAUCG} } 3' \\[4pt] \mathbf{\text{Coding Strand (}} 5' \to 3' \mathbf{\text{):}} & \quad \mathbf{5'\text{ ATCGATCGATCGATCGATCGATCGATCG } 3'} \end{aligned}

Step 2

Verbatim NCERT Reference

NCERT states verbatim under Transcription Unit: "The other strand which has the polarity (5'->3') and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand."

Step 3

Option Cross-Verification

Option (1) has reversed $3' \to 5'$ polarity. Options (2) and (3) contain RNA Uracil residues and complementary antisense sequences. Only Option (4) has the correct 5′ to 3′ polarity with DNA Thymine residues.

⭐

360° Option Elimination Engine Key Feature

Diagnose every choice: Know exactly why the right option works and why distractors fail.

4-Option Deep Scan

1 1

✗ Incorrect

Verdict & Scientific Reason:

Inverted polarity; the coding strand has 5′ to 3′ polarity, not 3′ to 5′.

⚠️

Student Fallacy (Why candidates pick this trap): Writing the correct sequence but with inverted 3′ to 5′ ends.

2 2

✗ Incorrect

Verdict & Scientific Reason:

Contains Uracil (impossible for a DNA strand) and is complementary rather than identical.

⚠️

Student Fallacy (Why candidates pick this trap): Generating a complementary RNA sequence.

3 3

✗ Incorrect

Verdict & Scientific Reason:

Contains Uracil and inverted complementary sequence.

⚠️

Student Fallacy (Why candidates pick this trap): Confusing template transcription with coding strand identity.

4 4

✓ 100% Correct

Verdict & Scientific Reason:

Exact match: same 5′ to 3′ polarity and sequence as mRNA, with Thymine (T) replacing Uracil (U).

💡

Why this is airtight: None; textbook verbatim rule application.

⚠️

NTA Trap Alert: Template vs. Coding Strand Complementarity Trap

Students frequently waste 2 minutes taking the reverse-complement of the mRNA. The question asks for the CODING strand, which is IDENTICAL to mRNA (just swap U for T).

🛡️ How to avoid the -1 mark: Remember: mRNA = Coding strand (just replace U with T, keep 5' to 3' direction).

📖

Core NEET Syllabus Standard

NCERT Biology · Molecular Basis of Inheritance Standard Benchmark

Core Scientific Principle Tested:

"The coding strand has the sequence same as RNA (except thymine at the place of uracil) and has 5' to 3' polarity."

Syllabus Focus: Transcription Unit

✓ Core NEET UG Syllabus Anchor Syllabus & Academic Standards ↗

Ready to attempt under real exam pressure?

Test your speed and accuracy in the authentic 200-minute timed NTA simulator.

Launch NEET 2023 CBT Test →

← Previous (Q.187) All Zoology Questions Grid Next (Q.189) →

Spotted a mistake in this solution? Report an error (support@mycompetitiveexams.com)

⚖️ Legal & Fair Dealing Notice: Sourced from publicly released NEET 2023 question papers and NEET answer keys for private study, research, and non-commercial educational practice under Fair Dealing (Section 52(1)(a) of the Indian Copyright Act, 1957). Not affiliated with or endorsed by NTA or NMC.

NEET 2023 Zoology Question 188 Solution

The 30-Second Exam Hall Shortcut: ⚡ Golden Rule: Coding Strand = mRNA (Just Replace U with T!)

Step-by-Step Rigorous Workflow & Mathematical Proof

Transcription Conventions in Molecular Genetics

Verbatim NCERT Reference

Option Cross-Verification

360° Option Elimination Engine Key Feature

NTA Trap Alert: Template vs. Coding Strand Complementarity Trap

Core NEET Syllabus Standard

Ready to attempt under real exam pressure?

🔗 Related Questions — Molecular Basis of Inheritance

Lac Operon & Constitutive Expression of i-Gene

Eukaryotic RNA Polymerase II & hnRNA Synthesis

RNA as the First Genetic Material & Evolution of Stable Double-Helical DNA

Salient Features of the Human Genome

Solve 4 NEET Questions a Day — One per Subject